Review



atf4 overexpression mr205957  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    OriGene atf4 overexpression mr205957
    Atf4 Overexpression Mr205957, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atf4+overexpression/Atf4+(NM_009716)+Mouse+Tagged+ORF+Clone/pmc11258489-102-3-3
    Average 90 stars, based on 1 article reviews
    atf4 overexpression mr205957 - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Over Expression:

    Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration.
    Article Snippet: For ATF4 manipulation, pLVX- scramble- mCherry lentiviral expression vector construct was commercially obtained (Clontech 631,987) and used as control. shATF4 knockdown (5′- CCAGAGCATTCCTTTAGTTTA- 3′) to generate pLV- U6- [shAtf4]- mCherry were ordered from Vectorbuilder. .. ATF4 overexpression from Origene (MR205957) was cloned into the expression vector to generate pLVX- E2F1aAtf4- Myc- DDK- V5- IRES- mCherry. ..

    Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration
    Article Snippet: For ATF4 manipulation, pLVX‐scramble‐mCherry lentiviral expression vector construct was commercially obtained (Clontech 631,987) and used as control. shATF4 knockdown (5′‐CCAGAGCATTCCTTTAGTTTA‐3′) to generate pLV‐U6‐[shAtf4]‐mCherry were ordered from Vectorbuilder. .. ATF4 overexpression from Origene (MR205957) was cloned into the expression vector to generate pLVX‐E2F1a‐Atf4‐Myc‐DDK‐V5‐IRES‐mCherry. ..

    Clone Assay:

    Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration.
    Article Snippet: For ATF4 manipulation, pLVX- scramble- mCherry lentiviral expression vector construct was commercially obtained (Clontech 631,987) and used as control. shATF4 knockdown (5′- CCAGAGCATTCCTTTAGTTTA- 3′) to generate pLV- U6- [shAtf4]- mCherry were ordered from Vectorbuilder. .. ATF4 overexpression from Origene (MR205957) was cloned into the expression vector to generate pLVX- E2F1aAtf4- Myc- DDK- V5- IRES- mCherry. ..

    Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration
    Article Snippet: For ATF4 manipulation, pLVX‐scramble‐mCherry lentiviral expression vector construct was commercially obtained (Clontech 631,987) and used as control. shATF4 knockdown (5′‐CCAGAGCATTCCTTTAGTTTA‐3′) to generate pLV‐U6‐[shAtf4]‐mCherry were ordered from Vectorbuilder. .. ATF4 overexpression from Origene (MR205957) was cloned into the expression vector to generate pLVX‐E2F1a‐Atf4‐Myc‐DDK‐V5‐IRES‐mCherry. ..

    Expressing:

    Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration.
    Article Snippet: For ATF4 manipulation, pLVX- scramble- mCherry lentiviral expression vector construct was commercially obtained (Clontech 631,987) and used as control. shATF4 knockdown (5′- CCAGAGCATTCCTTTAGTTTA- 3′) to generate pLV- U6- [shAtf4]- mCherry were ordered from Vectorbuilder. .. ATF4 overexpression from Origene (MR205957) was cloned into the expression vector to generate pLVX- E2F1aAtf4- Myc- DDK- V5- IRES- mCherry. ..

    Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration
    Article Snippet: For ATF4 manipulation, pLVX‐scramble‐mCherry lentiviral expression vector construct was commercially obtained (Clontech 631,987) and used as control. shATF4 knockdown (5′‐CCAGAGCATTCCTTTAGTTTA‐3′) to generate pLV‐U6‐[shAtf4]‐mCherry were ordered from Vectorbuilder. .. ATF4 overexpression from Origene (MR205957) was cloned into the expression vector to generate pLVX‐E2F1a‐Atf4‐Myc‐DDK‐V5‐IRES‐mCherry. ..

    Plasmid Preparation:

    Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration.
    Article Snippet: For ATF4 manipulation, pLVX- scramble- mCherry lentiviral expression vector construct was commercially obtained (Clontech 631,987) and used as control. shATF4 knockdown (5′- CCAGAGCATTCCTTTAGTTTA- 3′) to generate pLV- U6- [shAtf4]- mCherry were ordered from Vectorbuilder. .. ATF4 overexpression from Origene (MR205957) was cloned into the expression vector to generate pLVX- E2F1aAtf4- Myc- DDK- V5- IRES- mCherry. ..

    Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration
    Article Snippet: For ATF4 manipulation, pLVX‐scramble‐mCherry lentiviral expression vector construct was commercially obtained (Clontech 631,987) and used as control. shATF4 knockdown (5′‐CCAGAGCATTCCTTTAGTTTA‐3′) to generate pLV‐U6‐[shAtf4]‐mCherry were ordered from Vectorbuilder. .. ATF4 overexpression from Origene (MR205957) was cloned into the expression vector to generate pLVX‐E2F1a‐Atf4‐Myc‐DDK‐V5‐IRES‐mCherry. ..



    Similar Products

    93
    Addgene inc human overexpression plasmids for atf4
    POLR1A controls TFAM expression through <t>ATF4</t> A. Venn diagram of common differentially expressed genes (DEGs) in POLR1A high samples and POLR1A inhibitor-treated cell lines. DEGs were defined as those with a fold change (FC) > 1.5 and p < 0.05, determined using the limma package in R. The analysis incorporated four publicly available transcriptomic datasets: TCGA-MESO, EGAD00001001915, GSE145603 , and GSE204749 . Ten overlapping DEGs were identified across all datasets. B. Immunoblot analysis of MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox. Densitometric quantification of TFAM normalized to β-actin is shown beneath each band. C. Quantitative RT-PCR of MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox. Data are shown as mean ± SD (n = 4), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. D, E, Genetic co-dependency analysis identifies POLR1A- and TFAM-relevant gene sets (PRGs; TRGs). Co-dependency analysis was performed using RNAi datasets from DepMap (Achilles + DRIVE + Marcotte, DEMETER2). The X-axis represents gene rank based on correlation with POLR1A (D) or TFAM (E), while the Y-axis shows Pearson correlation coefficients of gene effect scores. Genes above the dashed line exhibit significant positive correlations (p < 0.05). The top 100 positively correlated genes (rank <100) are highlighted in red (PRGs) and orange (TRGs) and were subjected to transcription factor (TF) enrichment analysis using ChEA3. F, G, TF enrichment analysis of PRGs and TRGs identifies ATF4 a key mediator linking POLR1A and TFAM. Venn diagram showing 11 TFs commonly enriched in both PRGs and TRGs, based on ChEA3 analysis (F). Odds ratio (OR)-based enrichment analysis identifies ATF4 as the top-ranked shared TF, suggesting it may function as a key upstream regulator of both gene sets (G). H. UMAP visualization of coordinated RiBi and ATF4 activity in single PM cells. UMAP projections of scRNA-seq data from treatment-naïve PM samples (n = 3), with each cell scored by ssGSEA for RiBi (red gradient; GO_Ribosome_Biogenesis) and ATF4 transcriptional activity (blue gradient; ATF4_Q2 gene set, https://www.gsea-msigdb.org/gsea/msigdb/cards /ATF4_Q2). The merged overlay (bright pink) highlights cells with high scores in both pathways. I. UMAP visualization of TFAM expression mirrors RiBi and ATF4 activity in PM single cells. Using the same scRNA-seq dataset as in (H), cells are colored by ssGSEA scores for TFAM mRNA levels, revealing a spatial distribution that parallels high RiBi and ATF4 activity. J, K. qRT-PCR analysis of MESO1 and H2452 cells after transiently transfected with control (siCTRL) or ATF4-targeted siRNA (siATF4) for 48 h (J), with empty vector (vector) or ATF4 <t>overexpression</t> plasmid (oe-ATF4) for 48 h (K). Data are shown as mean ± SD (n = 4), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. L, M. Immunoblot analysis of POLR1A–ATF4–TFAM axis perturbations. MESO1 and H2452 cells were transiently transfected with siCTRL or siATF4 for 48 h (L), with or without ATF4 overexpression (oe-ATF4) (M). N, O. MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox.
    Human Overexpression Plasmids For Atf4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atf4+overexpression/pLVX-ATF4+mScarlet+NLS+(Plasmid+%23115969)/pmc12281011-53-0-5
    Average 93 stars, based on 1 article reviews
    human overexpression plasmids for atf4 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Santa Cruz Biotechnology overexpression lentiviruses for activating transcription factor 4 (atf4)
    POLR1A controls TFAM expression through <t>ATF4</t> A. Venn diagram of common differentially expressed genes (DEGs) in POLR1A high samples and POLR1A inhibitor-treated cell lines. DEGs were defined as those with a fold change (FC) > 1.5 and p < 0.05, determined using the limma package in R. The analysis incorporated four publicly available transcriptomic datasets: TCGA-MESO, EGAD00001001915, GSE145603 , and GSE204749 . Ten overlapping DEGs were identified across all datasets. B. Immunoblot analysis of MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox. Densitometric quantification of TFAM normalized to β-actin is shown beneath each band. C. Quantitative RT-PCR of MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox. Data are shown as mean ± SD (n = 4), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. D, E, Genetic co-dependency analysis identifies POLR1A- and TFAM-relevant gene sets (PRGs; TRGs). Co-dependency analysis was performed using RNAi datasets from DepMap (Achilles + DRIVE + Marcotte, DEMETER2). The X-axis represents gene rank based on correlation with POLR1A (D) or TFAM (E), while the Y-axis shows Pearson correlation coefficients of gene effect scores. Genes above the dashed line exhibit significant positive correlations (p < 0.05). The top 100 positively correlated genes (rank <100) are highlighted in red (PRGs) and orange (TRGs) and were subjected to transcription factor (TF) enrichment analysis using ChEA3. F, G, TF enrichment analysis of PRGs and TRGs identifies ATF4 a key mediator linking POLR1A and TFAM. Venn diagram showing 11 TFs commonly enriched in both PRGs and TRGs, based on ChEA3 analysis (F). Odds ratio (OR)-based enrichment analysis identifies ATF4 as the top-ranked shared TF, suggesting it may function as a key upstream regulator of both gene sets (G). H. UMAP visualization of coordinated RiBi and ATF4 activity in single PM cells. UMAP projections of scRNA-seq data from treatment-naïve PM samples (n = 3), with each cell scored by ssGSEA for RiBi (red gradient; GO_Ribosome_Biogenesis) and ATF4 transcriptional activity (blue gradient; ATF4_Q2 gene set, https://www.gsea-msigdb.org/gsea/msigdb/cards /ATF4_Q2). The merged overlay (bright pink) highlights cells with high scores in both pathways. I. UMAP visualization of TFAM expression mirrors RiBi and ATF4 activity in PM single cells. Using the same scRNA-seq dataset as in (H), cells are colored by ssGSEA scores for TFAM mRNA levels, revealing a spatial distribution that parallels high RiBi and ATF4 activity. J, K. qRT-PCR analysis of MESO1 and H2452 cells after transiently transfected with control (siCTRL) or ATF4-targeted siRNA (siATF4) for 48 h (J), with empty vector (vector) or ATF4 <t>overexpression</t> plasmid (oe-ATF4) for 48 h (K). Data are shown as mean ± SD (n = 4), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. L, M. Immunoblot analysis of POLR1A–ATF4–TFAM axis perturbations. MESO1 and H2452 cells were transiently transfected with siCTRL or siATF4 for 48 h (L), with or without ATF4 overexpression (oe-ATF4) (M). N, O. MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox.
    Overexpression Lentiviruses For Activating Transcription Factor 4 (Atf4), supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atf4+overexpression/rabbit+anti+atf3/10__1016_slash_s1875___5364_ascii40_25_ascii41_60841___7-107-1-24
    Average 90 stars, based on 1 article reviews
    overexpression lentiviruses for activating transcription factor 4 (atf4) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    92
    Addgene inc atf4 overexpression vector
    POLR1A controls TFAM expression through <t>ATF4</t> A. Venn diagram of common differentially expressed genes (DEGs) in POLR1A high samples and POLR1A inhibitor-treated cell lines. DEGs were defined as those with a fold change (FC) > 1.5 and p < 0.05, determined using the limma package in R. The analysis incorporated four publicly available transcriptomic datasets: TCGA-MESO, EGAD00001001915, GSE145603 , and GSE204749 . Ten overlapping DEGs were identified across all datasets. B. Immunoblot analysis of MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox. Densitometric quantification of TFAM normalized to β-actin is shown beneath each band. C. Quantitative RT-PCR of MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox. Data are shown as mean ± SD (n = 4), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. D, E, Genetic co-dependency analysis identifies POLR1A- and TFAM-relevant gene sets (PRGs; TRGs). Co-dependency analysis was performed using RNAi datasets from DepMap (Achilles + DRIVE + Marcotte, DEMETER2). The X-axis represents gene rank based on correlation with POLR1A (D) or TFAM (E), while the Y-axis shows Pearson correlation coefficients of gene effect scores. Genes above the dashed line exhibit significant positive correlations (p < 0.05). The top 100 positively correlated genes (rank <100) are highlighted in red (PRGs) and orange (TRGs) and were subjected to transcription factor (TF) enrichment analysis using ChEA3. F, G, TF enrichment analysis of PRGs and TRGs identifies ATF4 a key mediator linking POLR1A and TFAM. Venn diagram showing 11 TFs commonly enriched in both PRGs and TRGs, based on ChEA3 analysis (F). Odds ratio (OR)-based enrichment analysis identifies ATF4 as the top-ranked shared TF, suggesting it may function as a key upstream regulator of both gene sets (G). H. UMAP visualization of coordinated RiBi and ATF4 activity in single PM cells. UMAP projections of scRNA-seq data from treatment-naïve PM samples (n = 3), with each cell scored by ssGSEA for RiBi (red gradient; GO_Ribosome_Biogenesis) and ATF4 transcriptional activity (blue gradient; ATF4_Q2 gene set, https://www.gsea-msigdb.org/gsea/msigdb/cards /ATF4_Q2). The merged overlay (bright pink) highlights cells with high scores in both pathways. I. UMAP visualization of TFAM expression mirrors RiBi and ATF4 activity in PM single cells. Using the same scRNA-seq dataset as in (H), cells are colored by ssGSEA scores for TFAM mRNA levels, revealing a spatial distribution that parallels high RiBi and ATF4 activity. J, K. qRT-PCR analysis of MESO1 and H2452 cells after transiently transfected with control (siCTRL) or ATF4-targeted siRNA (siATF4) for 48 h (J), with empty vector (vector) or ATF4 <t>overexpression</t> plasmid (oe-ATF4) for 48 h (K). Data are shown as mean ± SD (n = 4), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. L, M. Immunoblot analysis of POLR1A–ATF4–TFAM axis perturbations. MESO1 and H2452 cells were transiently transfected with siCTRL or siATF4 for 48 h (L), with or without ATF4 overexpression (oe-ATF4) (M). N, O. MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox.
    Atf4 Overexpression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atf4+overexpression/ATF4+10%3A+5%E2%80%99ATF4%2EuORF1%2EGFP+(Plasmid+%2321857)/pmc11873131__12276_2025_1403_MOESM1_ESM-80-20-23
    Average 92 stars, based on 1 article reviews
    atf4 overexpression vector - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    90
    VectorBuilder GmbH atf4 overexpressions control (vb900139-8319ega)
    POLR1A controls TFAM expression through <t>ATF4</t> A. Venn diagram of common differentially expressed genes (DEGs) in POLR1A high samples and POLR1A inhibitor-treated cell lines. DEGs were defined as those with a fold change (FC) > 1.5 and p < 0.05, determined using the limma package in R. The analysis incorporated four publicly available transcriptomic datasets: TCGA-MESO, EGAD00001001915, GSE145603 , and GSE204749 . Ten overlapping DEGs were identified across all datasets. B. Immunoblot analysis of MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox. Densitometric quantification of TFAM normalized to β-actin is shown beneath each band. C. Quantitative RT-PCR of MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox. Data are shown as mean ± SD (n = 4), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. D, E, Genetic co-dependency analysis identifies POLR1A- and TFAM-relevant gene sets (PRGs; TRGs). Co-dependency analysis was performed using RNAi datasets from DepMap (Achilles + DRIVE + Marcotte, DEMETER2). The X-axis represents gene rank based on correlation with POLR1A (D) or TFAM (E), while the Y-axis shows Pearson correlation coefficients of gene effect scores. Genes above the dashed line exhibit significant positive correlations (p < 0.05). The top 100 positively correlated genes (rank <100) are highlighted in red (PRGs) and orange (TRGs) and were subjected to transcription factor (TF) enrichment analysis using ChEA3. F, G, TF enrichment analysis of PRGs and TRGs identifies ATF4 a key mediator linking POLR1A and TFAM. Venn diagram showing 11 TFs commonly enriched in both PRGs and TRGs, based on ChEA3 analysis (F). Odds ratio (OR)-based enrichment analysis identifies ATF4 as the top-ranked shared TF, suggesting it may function as a key upstream regulator of both gene sets (G). H. UMAP visualization of coordinated RiBi and ATF4 activity in single PM cells. UMAP projections of scRNA-seq data from treatment-naïve PM samples (n = 3), with each cell scored by ssGSEA for RiBi (red gradient; GO_Ribosome_Biogenesis) and ATF4 transcriptional activity (blue gradient; ATF4_Q2 gene set, https://www.gsea-msigdb.org/gsea/msigdb/cards /ATF4_Q2). The merged overlay (bright pink) highlights cells with high scores in both pathways. I. UMAP visualization of TFAM expression mirrors RiBi and ATF4 activity in PM single cells. Using the same scRNA-seq dataset as in (H), cells are colored by ssGSEA scores for TFAM mRNA levels, revealing a spatial distribution that parallels high RiBi and ATF4 activity. J, K. qRT-PCR analysis of MESO1 and H2452 cells after transiently transfected with control (siCTRL) or ATF4-targeted siRNA (siATF4) for 48 h (J), with empty vector (vector) or ATF4 <t>overexpression</t> plasmid (oe-ATF4) for 48 h (K). Data are shown as mean ± SD (n = 4), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. L, M. Immunoblot analysis of POLR1A–ATF4–TFAM axis perturbations. MESO1 and H2452 cells were transiently transfected with siCTRL or siATF4 for 48 h (L), with or without ATF4 overexpression (oe-ATF4) (M). N, O. MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox.
    Atf4 Overexpressions Control (Vb900139 8319ega), supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atf4+overexpression/atf4+overexpressions+control++vb900139+8319ega+/pm39900965-170-1-12
    Average 90 stars, based on 1 article reviews
    atf4 overexpressions control (vb900139-8319ega) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    VectorBuilder GmbH atf4 overexpressions control (vb900139-8319ega
    POLR1A controls TFAM expression through <t>ATF4</t> A. Venn diagram of common differentially expressed genes (DEGs) in POLR1A high samples and POLR1A inhibitor-treated cell lines. DEGs were defined as those with a fold change (FC) > 1.5 and p < 0.05, determined using the limma package in R. The analysis incorporated four publicly available transcriptomic datasets: TCGA-MESO, EGAD00001001915, GSE145603 , and GSE204749 . Ten overlapping DEGs were identified across all datasets. B. Immunoblot analysis of MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox. Densitometric quantification of TFAM normalized to β-actin is shown beneath each band. C. Quantitative RT-PCR of MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox. Data are shown as mean ± SD (n = 4), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. D, E, Genetic co-dependency analysis identifies POLR1A- and TFAM-relevant gene sets (PRGs; TRGs). Co-dependency analysis was performed using RNAi datasets from DepMap (Achilles + DRIVE + Marcotte, DEMETER2). The X-axis represents gene rank based on correlation with POLR1A (D) or TFAM (E), while the Y-axis shows Pearson correlation coefficients of gene effect scores. Genes above the dashed line exhibit significant positive correlations (p < 0.05). The top 100 positively correlated genes (rank <100) are highlighted in red (PRGs) and orange (TRGs) and were subjected to transcription factor (TF) enrichment analysis using ChEA3. F, G, TF enrichment analysis of PRGs and TRGs identifies ATF4 a key mediator linking POLR1A and TFAM. Venn diagram showing 11 TFs commonly enriched in both PRGs and TRGs, based on ChEA3 analysis (F). Odds ratio (OR)-based enrichment analysis identifies ATF4 as the top-ranked shared TF, suggesting it may function as a key upstream regulator of both gene sets (G). H. UMAP visualization of coordinated RiBi and ATF4 activity in single PM cells. UMAP projections of scRNA-seq data from treatment-naïve PM samples (n = 3), with each cell scored by ssGSEA for RiBi (red gradient; GO_Ribosome_Biogenesis) and ATF4 transcriptional activity (blue gradient; ATF4_Q2 gene set, https://www.gsea-msigdb.org/gsea/msigdb/cards /ATF4_Q2). The merged overlay (bright pink) highlights cells with high scores in both pathways. I. UMAP visualization of TFAM expression mirrors RiBi and ATF4 activity in PM single cells. Using the same scRNA-seq dataset as in (H), cells are colored by ssGSEA scores for TFAM mRNA levels, revealing a spatial distribution that parallels high RiBi and ATF4 activity. J, K. qRT-PCR analysis of MESO1 and H2452 cells after transiently transfected with control (siCTRL) or ATF4-targeted siRNA (siATF4) for 48 h (J), with empty vector (vector) or ATF4 <t>overexpression</t> plasmid (oe-ATF4) for 48 h (K). Data are shown as mean ± SD (n = 4), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. L, M. Immunoblot analysis of POLR1A–ATF4–TFAM axis perturbations. MESO1 and H2452 cells were transiently transfected with siCTRL or siATF4 for 48 h (L), with or without ATF4 overexpression (oe-ATF4) (M). N, O. MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox.
    Atf4 Overexpressions Control (Vb900139 8319ega, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atf4+overexpression/atf4+overexpressions+control++vb900139+8319ega+/pmc11791087-148-1-12
    Average 90 stars, based on 1 article reviews
    atf4 overexpressions control (vb900139-8319ega - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Shanghai Genechem Ltd lentiviral vectors for atf4 overexpression
    POLR1A controls TFAM expression through <t>ATF4</t> A. Venn diagram of common differentially expressed genes (DEGs) in POLR1A high samples and POLR1A inhibitor-treated cell lines. DEGs were defined as those with a fold change (FC) > 1.5 and p < 0.05, determined using the limma package in R. The analysis incorporated four publicly available transcriptomic datasets: TCGA-MESO, EGAD00001001915, GSE145603 , and GSE204749 . Ten overlapping DEGs were identified across all datasets. B. Immunoblot analysis of MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox. Densitometric quantification of TFAM normalized to β-actin is shown beneath each band. C. Quantitative RT-PCR of MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox. Data are shown as mean ± SD (n = 4), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. D, E, Genetic co-dependency analysis identifies POLR1A- and TFAM-relevant gene sets (PRGs; TRGs). Co-dependency analysis was performed using RNAi datasets from DepMap (Achilles + DRIVE + Marcotte, DEMETER2). The X-axis represents gene rank based on correlation with POLR1A (D) or TFAM (E), while the Y-axis shows Pearson correlation coefficients of gene effect scores. Genes above the dashed line exhibit significant positive correlations (p < 0.05). The top 100 positively correlated genes (rank <100) are highlighted in red (PRGs) and orange (TRGs) and were subjected to transcription factor (TF) enrichment analysis using ChEA3. F, G, TF enrichment analysis of PRGs and TRGs identifies ATF4 a key mediator linking POLR1A and TFAM. Venn diagram showing 11 TFs commonly enriched in both PRGs and TRGs, based on ChEA3 analysis (F). Odds ratio (OR)-based enrichment analysis identifies ATF4 as the top-ranked shared TF, suggesting it may function as a key upstream regulator of both gene sets (G). H. UMAP visualization of coordinated RiBi and ATF4 activity in single PM cells. UMAP projections of scRNA-seq data from treatment-naïve PM samples (n = 3), with each cell scored by ssGSEA for RiBi (red gradient; GO_Ribosome_Biogenesis) and ATF4 transcriptional activity (blue gradient; ATF4_Q2 gene set, https://www.gsea-msigdb.org/gsea/msigdb/cards /ATF4_Q2). The merged overlay (bright pink) highlights cells with high scores in both pathways. I. UMAP visualization of TFAM expression mirrors RiBi and ATF4 activity in PM single cells. Using the same scRNA-seq dataset as in (H), cells are colored by ssGSEA scores for TFAM mRNA levels, revealing a spatial distribution that parallels high RiBi and ATF4 activity. J, K. qRT-PCR analysis of MESO1 and H2452 cells after transiently transfected with control (siCTRL) or ATF4-targeted siRNA (siATF4) for 48 h (J), with empty vector (vector) or ATF4 <t>overexpression</t> plasmid (oe-ATF4) for 48 h (K). Data are shown as mean ± SD (n = 4), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. L, M. Immunoblot analysis of POLR1A–ATF4–TFAM axis perturbations. MESO1 and H2452 cells were transiently transfected with siCTRL or siATF4 for 48 h (L), with or without ATF4 overexpression (oe-ATF4) (M). N, O. MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox.
    Lentiviral Vectors For Atf4 Overexpression, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atf4+overexpression/lentiviral+atf4+specific+shrna/pm39803678-43-3-17
    Average 90 stars, based on 1 article reviews
    lentiviral vectors for atf4 overexpression - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Shanghai GenePharma pcdna3.1-atf4 overexpression plasmid
    POLR1A controls TFAM expression through <t>ATF4</t> A. Venn diagram of common differentially expressed genes (DEGs) in POLR1A high samples and POLR1A inhibitor-treated cell lines. DEGs were defined as those with a fold change (FC) > 1.5 and p < 0.05, determined using the limma package in R. The analysis incorporated four publicly available transcriptomic datasets: TCGA-MESO, EGAD00001001915, GSE145603 , and GSE204749 . Ten overlapping DEGs were identified across all datasets. B. Immunoblot analysis of MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox. Densitometric quantification of TFAM normalized to β-actin is shown beneath each band. C. Quantitative RT-PCR of MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox. Data are shown as mean ± SD (n = 4), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. D, E, Genetic co-dependency analysis identifies POLR1A- and TFAM-relevant gene sets (PRGs; TRGs). Co-dependency analysis was performed using RNAi datasets from DepMap (Achilles + DRIVE + Marcotte, DEMETER2). The X-axis represents gene rank based on correlation with POLR1A (D) or TFAM (E), while the Y-axis shows Pearson correlation coefficients of gene effect scores. Genes above the dashed line exhibit significant positive correlations (p < 0.05). The top 100 positively correlated genes (rank <100) are highlighted in red (PRGs) and orange (TRGs) and were subjected to transcription factor (TF) enrichment analysis using ChEA3. F, G, TF enrichment analysis of PRGs and TRGs identifies ATF4 a key mediator linking POLR1A and TFAM. Venn diagram showing 11 TFs commonly enriched in both PRGs and TRGs, based on ChEA3 analysis (F). Odds ratio (OR)-based enrichment analysis identifies ATF4 as the top-ranked shared TF, suggesting it may function as a key upstream regulator of both gene sets (G). H. UMAP visualization of coordinated RiBi and ATF4 activity in single PM cells. UMAP projections of scRNA-seq data from treatment-naïve PM samples (n = 3), with each cell scored by ssGSEA for RiBi (red gradient; GO_Ribosome_Biogenesis) and ATF4 transcriptional activity (blue gradient; ATF4_Q2 gene set, https://www.gsea-msigdb.org/gsea/msigdb/cards /ATF4_Q2). The merged overlay (bright pink) highlights cells with high scores in both pathways. I. UMAP visualization of TFAM expression mirrors RiBi and ATF4 activity in PM single cells. Using the same scRNA-seq dataset as in (H), cells are colored by ssGSEA scores for TFAM mRNA levels, revealing a spatial distribution that parallels high RiBi and ATF4 activity. J, K. qRT-PCR analysis of MESO1 and H2452 cells after transiently transfected with control (siCTRL) or ATF4-targeted siRNA (siATF4) for 48 h (J), with empty vector (vector) or ATF4 <t>overexpression</t> plasmid (oe-ATF4) for 48 h (K). Data are shown as mean ± SD (n = 4), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. L, M. Immunoblot analysis of POLR1A–ATF4–TFAM axis perturbations. MESO1 and H2452 cells were transiently transfected with siCTRL or siATF4 for 48 h (L), with or without ATF4 overexpression (oe-ATF4) (M). N, O. MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox.
    Pcdna3.1 Atf4 Overexpression Plasmid, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atf4+overexpression/double+stranded+sirna+targeting+mouse+atf4/pm39090107-243-0-20
    Average 90 stars, based on 1 article reviews
    pcdna3.1-atf4 overexpression plasmid - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    OriGene atf4 overexpression mr205957
    POLR1A controls TFAM expression through <t>ATF4</t> A. Venn diagram of common differentially expressed genes (DEGs) in POLR1A high samples and POLR1A inhibitor-treated cell lines. DEGs were defined as those with a fold change (FC) > 1.5 and p < 0.05, determined using the limma package in R. The analysis incorporated four publicly available transcriptomic datasets: TCGA-MESO, EGAD00001001915, GSE145603 , and GSE204749 . Ten overlapping DEGs were identified across all datasets. B. Immunoblot analysis of MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox. Densitometric quantification of TFAM normalized to β-actin is shown beneath each band. C. Quantitative RT-PCR of MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox. Data are shown as mean ± SD (n = 4), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. D, E, Genetic co-dependency analysis identifies POLR1A- and TFAM-relevant gene sets (PRGs; TRGs). Co-dependency analysis was performed using RNAi datasets from DepMap (Achilles + DRIVE + Marcotte, DEMETER2). The X-axis represents gene rank based on correlation with POLR1A (D) or TFAM (E), while the Y-axis shows Pearson correlation coefficients of gene effect scores. Genes above the dashed line exhibit significant positive correlations (p < 0.05). The top 100 positively correlated genes (rank <100) are highlighted in red (PRGs) and orange (TRGs) and were subjected to transcription factor (TF) enrichment analysis using ChEA3. F, G, TF enrichment analysis of PRGs and TRGs identifies ATF4 a key mediator linking POLR1A and TFAM. Venn diagram showing 11 TFs commonly enriched in both PRGs and TRGs, based on ChEA3 analysis (F). Odds ratio (OR)-based enrichment analysis identifies ATF4 as the top-ranked shared TF, suggesting it may function as a key upstream regulator of both gene sets (G). H. UMAP visualization of coordinated RiBi and ATF4 activity in single PM cells. UMAP projections of scRNA-seq data from treatment-naïve PM samples (n = 3), with each cell scored by ssGSEA for RiBi (red gradient; GO_Ribosome_Biogenesis) and ATF4 transcriptional activity (blue gradient; ATF4_Q2 gene set, https://www.gsea-msigdb.org/gsea/msigdb/cards /ATF4_Q2). The merged overlay (bright pink) highlights cells with high scores in both pathways. I. UMAP visualization of TFAM expression mirrors RiBi and ATF4 activity in PM single cells. Using the same scRNA-seq dataset as in (H), cells are colored by ssGSEA scores for TFAM mRNA levels, revealing a spatial distribution that parallels high RiBi and ATF4 activity. J, K. qRT-PCR analysis of MESO1 and H2452 cells after transiently transfected with control (siCTRL) or ATF4-targeted siRNA (siATF4) for 48 h (J), with empty vector (vector) or ATF4 <t>overexpression</t> plasmid (oe-ATF4) for 48 h (K). Data are shown as mean ± SD (n = 4), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. L, M. Immunoblot analysis of POLR1A–ATF4–TFAM axis perturbations. MESO1 and H2452 cells were transiently transfected with siCTRL or siATF4 for 48 h (L), with or without ATF4 overexpression (oe-ATF4) (M). N, O. MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox.
    Atf4 Overexpression Mr205957, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atf4+overexpression/Atf4+(NM_009716)+Mouse+Tagged+ORF+Clone/pmc11258489-102-3-3
    Average 90 stars, based on 1 article reviews
    atf4 overexpression mr205957 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    92
    OriGene atf4 overexpression
    Single‐cell RNA‐Seq analysis identifies <t>Atf4</t> stress response pathway downstream of mitochondrial dysfunction. (a) Experimental setup. (b) UMAP scatterplot showing the distribution of CT and Opa1 cKO‐derived cells clusters. (c) Heatmap of cluster‐specific and genotype‐specific differential gene expression. (d) UMAP of individual genes that are differentially regulated in all the clusters highlighting Atf4 pathway. (e) Violin plots representing mitochondrial gene expression, stress response genes, and differentiation genes in each cluster split by sample. (f) RNA velocity analysis shows the differentiation direction shown by the vectors separated by sample. (g) Panels of magnified views of the transition between cluster 1 (activated NSCs) and cluster 2 (Differentiating NSCs). (h) The proportion of spliced and unspliced RNA in all the clusters split by sample.
    Atf4 Overexpression, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atf4+overexpression/Atf4+(NM_009716)+Mouse+Tagged+ORF+Clone/pmc11258489-102-0-3
    Average 92 stars, based on 1 article reviews
    atf4 overexpression - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    Image Search Results


    POLR1A controls TFAM expression through ATF4 A. Venn diagram of common differentially expressed genes (DEGs) in POLR1A high samples and POLR1A inhibitor-treated cell lines. DEGs were defined as those with a fold change (FC) > 1.5 and p < 0.05, determined using the limma package in R. The analysis incorporated four publicly available transcriptomic datasets: TCGA-MESO, EGAD00001001915, GSE145603 , and GSE204749 . Ten overlapping DEGs were identified across all datasets. B. Immunoblot analysis of MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox. Densitometric quantification of TFAM normalized to β-actin is shown beneath each band. C. Quantitative RT-PCR of MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox. Data are shown as mean ± SD (n = 4), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. D, E, Genetic co-dependency analysis identifies POLR1A- and TFAM-relevant gene sets (PRGs; TRGs). Co-dependency analysis was performed using RNAi datasets from DepMap (Achilles + DRIVE + Marcotte, DEMETER2). The X-axis represents gene rank based on correlation with POLR1A (D) or TFAM (E), while the Y-axis shows Pearson correlation coefficients of gene effect scores. Genes above the dashed line exhibit significant positive correlations (p < 0.05). The top 100 positively correlated genes (rank <100) are highlighted in red (PRGs) and orange (TRGs) and were subjected to transcription factor (TF) enrichment analysis using ChEA3. F, G, TF enrichment analysis of PRGs and TRGs identifies ATF4 a key mediator linking POLR1A and TFAM. Venn diagram showing 11 TFs commonly enriched in both PRGs and TRGs, based on ChEA3 analysis (F). Odds ratio (OR)-based enrichment analysis identifies ATF4 as the top-ranked shared TF, suggesting it may function as a key upstream regulator of both gene sets (G). H. UMAP visualization of coordinated RiBi and ATF4 activity in single PM cells. UMAP projections of scRNA-seq data from treatment-naïve PM samples (n = 3), with each cell scored by ssGSEA for RiBi (red gradient; GO_Ribosome_Biogenesis) and ATF4 transcriptional activity (blue gradient; ATF4_Q2 gene set, https://www.gsea-msigdb.org/gsea/msigdb/cards /ATF4_Q2). The merged overlay (bright pink) highlights cells with high scores in both pathways. I. UMAP visualization of TFAM expression mirrors RiBi and ATF4 activity in PM single cells. Using the same scRNA-seq dataset as in (H), cells are colored by ssGSEA scores for TFAM mRNA levels, revealing a spatial distribution that parallels high RiBi and ATF4 activity. J, K. qRT-PCR analysis of MESO1 and H2452 cells after transiently transfected with control (siCTRL) or ATF4-targeted siRNA (siATF4) for 48 h (J), with empty vector (vector) or ATF4 overexpression plasmid (oe-ATF4) for 48 h (K). Data are shown as mean ± SD (n = 4), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. L, M. Immunoblot analysis of POLR1A–ATF4–TFAM axis perturbations. MESO1 and H2452 cells were transiently transfected with siCTRL or siATF4 for 48 h (L), with or without ATF4 overexpression (oe-ATF4) (M). N, O. MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox.

    Journal: Redox Biology

    Article Title: POLR1A inhibits ferroptosis by regulating TFAM-mediated mitophagy and iron homeostasis

    doi: 10.1016/j.redox.2025.103758

    Figure Lengend Snippet: POLR1A controls TFAM expression through ATF4 A. Venn diagram of common differentially expressed genes (DEGs) in POLR1A high samples and POLR1A inhibitor-treated cell lines. DEGs were defined as those with a fold change (FC) > 1.5 and p < 0.05, determined using the limma package in R. The analysis incorporated four publicly available transcriptomic datasets: TCGA-MESO, EGAD00001001915, GSE145603 , and GSE204749 . Ten overlapping DEGs were identified across all datasets. B. Immunoblot analysis of MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox. Densitometric quantification of TFAM normalized to β-actin is shown beneath each band. C. Quantitative RT-PCR of MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox. Data are shown as mean ± SD (n = 4), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. D, E, Genetic co-dependency analysis identifies POLR1A- and TFAM-relevant gene sets (PRGs; TRGs). Co-dependency analysis was performed using RNAi datasets from DepMap (Achilles + DRIVE + Marcotte, DEMETER2). The X-axis represents gene rank based on correlation with POLR1A (D) or TFAM (E), while the Y-axis shows Pearson correlation coefficients of gene effect scores. Genes above the dashed line exhibit significant positive correlations (p < 0.05). The top 100 positively correlated genes (rank <100) are highlighted in red (PRGs) and orange (TRGs) and were subjected to transcription factor (TF) enrichment analysis using ChEA3. F, G, TF enrichment analysis of PRGs and TRGs identifies ATF4 a key mediator linking POLR1A and TFAM. Venn diagram showing 11 TFs commonly enriched in both PRGs and TRGs, based on ChEA3 analysis (F). Odds ratio (OR)-based enrichment analysis identifies ATF4 as the top-ranked shared TF, suggesting it may function as a key upstream regulator of both gene sets (G). H. UMAP visualization of coordinated RiBi and ATF4 activity in single PM cells. UMAP projections of scRNA-seq data from treatment-naïve PM samples (n = 3), with each cell scored by ssGSEA for RiBi (red gradient; GO_Ribosome_Biogenesis) and ATF4 transcriptional activity (blue gradient; ATF4_Q2 gene set, https://www.gsea-msigdb.org/gsea/msigdb/cards /ATF4_Q2). The merged overlay (bright pink) highlights cells with high scores in both pathways. I. UMAP visualization of TFAM expression mirrors RiBi and ATF4 activity in PM single cells. Using the same scRNA-seq dataset as in (H), cells are colored by ssGSEA scores for TFAM mRNA levels, revealing a spatial distribution that parallels high RiBi and ATF4 activity. J, K. qRT-PCR analysis of MESO1 and H2452 cells after transiently transfected with control (siCTRL) or ATF4-targeted siRNA (siATF4) for 48 h (J), with empty vector (vector) or ATF4 overexpression plasmid (oe-ATF4) for 48 h (K). Data are shown as mean ± SD (n = 4), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. L, M. Immunoblot analysis of POLR1A–ATF4–TFAM axis perturbations. MESO1 and H2452 cells were transiently transfected with siCTRL or siATF4 for 48 h (L), with or without ATF4 overexpression (oe-ATF4) (M). N, O. MESO1 and H2452 cells expressing Dox-inducible shCTRL or shPOLR1A after 48h treatment with 500 nM Dox.

    Article Snippet: Human overexpression plasmids for ATF4 (Addgene #115969) and TFAM (pLV [Exp]-Bsd-CMV > hTFAM [ NM_003201.3 ]) were obtained from Addgene and VectorBuilder, separately.

    Techniques: Expressing, Western Blot, Quantitative RT-PCR, Activity Assay, Transfection, Control, Plasmid Preparation, Over Expression

    The POLR1A/TFAM promotes ferroptosis resistance in PM cells A, B. Cell viability assay of MESO1 and H2452 cells expressing Dox–inducible shCTRL, shPOLR1A, or shTFAM, with or without TFAM overexpression (oeTFAM), after treated with 500 nM Dox and increasing concentrations of RSL3 for 48h, in the presence or absence of Fer-1 (5 μM). Data are presented as mean ± SD (n = 6). C. Cell death assay of MESO1 and H2452 cells expressing Dox–inducible shCTRL, shPOLR1A, or shTFAM, with or without TFAM overexpression (oeTFAM), after treated with 500 nM Dox and 200 nM RSL3 for 48h, in the presence or absence of Fer-1 (5 μM). Data are presented as mean ± SD (n = 5), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. D. Clonogenic assay of MESO1 and H2452 cells with Dox-inducible shCTRL, shPOLR1A, or shTFAM, with or without TFAM overexpression (oeTFAM), after treated with Dox (500 nM) and increasing concentrations of RSL3 for 48h, in the presence or absence of 5 μM Fer-1. E. MESO1 and H2452 cells expressing Dox–inducible shCTRL, shPOLR1A, or shTFAM were treated with Dox (500 nM) and RSL3 (100 nM) for 48 h, with or without TFAM overexpression (oeTFAM) and in the presence or absence of deferoxamine (DFO; 5 μM) and Fer-1 (5 μM). Lipid peroxidation was quantified by C11-BODIPY staining and flow cytometry. Data are presented as MFI ±95 % CI (n = 3), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. F, PARK2 silencing suppresses POLR1A- and TFAM deficiency-induced lipid peroxidation. MESO1 and H2452 cells with Dox-inducible shPOLR1A or shTFAM were treated with 500 nM Dox for 48 h, in the presence or absence of siPARK2. Lipid peroxidation was quantified by C11-BODIPY staining and flow cytometry. Data are shown as MFI ±95 % CI (n = 3), with ∗∗∗p < 0.001; ∗∗∗∗p < 0.0001 by unpaired t -test.

    Journal: Redox Biology

    Article Title: POLR1A inhibits ferroptosis by regulating TFAM-mediated mitophagy and iron homeostasis

    doi: 10.1016/j.redox.2025.103758

    Figure Lengend Snippet: The POLR1A/TFAM promotes ferroptosis resistance in PM cells A, B. Cell viability assay of MESO1 and H2452 cells expressing Dox–inducible shCTRL, shPOLR1A, or shTFAM, with or without TFAM overexpression (oeTFAM), after treated with 500 nM Dox and increasing concentrations of RSL3 for 48h, in the presence or absence of Fer-1 (5 μM). Data are presented as mean ± SD (n = 6). C. Cell death assay of MESO1 and H2452 cells expressing Dox–inducible shCTRL, shPOLR1A, or shTFAM, with or without TFAM overexpression (oeTFAM), after treated with 500 nM Dox and 200 nM RSL3 for 48h, in the presence or absence of Fer-1 (5 μM). Data are presented as mean ± SD (n = 5), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. D. Clonogenic assay of MESO1 and H2452 cells with Dox-inducible shCTRL, shPOLR1A, or shTFAM, with or without TFAM overexpression (oeTFAM), after treated with Dox (500 nM) and increasing concentrations of RSL3 for 48h, in the presence or absence of 5 μM Fer-1. E. MESO1 and H2452 cells expressing Dox–inducible shCTRL, shPOLR1A, or shTFAM were treated with Dox (500 nM) and RSL3 (100 nM) for 48 h, with or without TFAM overexpression (oeTFAM) and in the presence or absence of deferoxamine (DFO; 5 μM) and Fer-1 (5 μM). Lipid peroxidation was quantified by C11-BODIPY staining and flow cytometry. Data are presented as MFI ±95 % CI (n = 3), with ns (p ≥ 0.05), ∗p < 0.05, ∗∗p < 0.01, ∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t -test. F, PARK2 silencing suppresses POLR1A- and TFAM deficiency-induced lipid peroxidation. MESO1 and H2452 cells with Dox-inducible shPOLR1A or shTFAM were treated with 500 nM Dox for 48 h, in the presence or absence of siPARK2. Lipid peroxidation was quantified by C11-BODIPY staining and flow cytometry. Data are shown as MFI ±95 % CI (n = 3), with ∗∗∗p < 0.001; ∗∗∗∗p < 0.0001 by unpaired t -test.

    Article Snippet: Human overexpression plasmids for ATF4 (Addgene #115969) and TFAM (pLV [Exp]-Bsd-CMV > hTFAM [ NM_003201.3 ]) were obtained from Addgene and VectorBuilder, separately.

    Techniques: Viability Assay, Expressing, Over Expression, Clonogenic Assay, Staining, Flow Cytometry

    Working model of the POLR1A–ATF4–TFAM axis in ferroptosis defense. Under homeostatic conditions, POLR1A promotes ATF4–mediated transcription of TFAM, ensuring proper mitochondrial gene expression and function. TFAM supports mitochondrial integrity, limiting mitophagy and the consequent release of labile Fe 2+ , thereby preventing iron-driven lipid peroxidation and ferroptotic cell death. Inhibition of POLR1A or disruption of ATF4–TFAM signaling triggers excessive mitophagy, elevates cytosolic Fe 2+ , and sensitizes cancer cells to GPX4 inhibitors (e.g., RSL3), leading to hyperactivation of ferroptosis.

    Journal: Redox Biology

    Article Title: POLR1A inhibits ferroptosis by regulating TFAM-mediated mitophagy and iron homeostasis

    doi: 10.1016/j.redox.2025.103758

    Figure Lengend Snippet: Working model of the POLR1A–ATF4–TFAM axis in ferroptosis defense. Under homeostatic conditions, POLR1A promotes ATF4–mediated transcription of TFAM, ensuring proper mitochondrial gene expression and function. TFAM supports mitochondrial integrity, limiting mitophagy and the consequent release of labile Fe 2+ , thereby preventing iron-driven lipid peroxidation and ferroptotic cell death. Inhibition of POLR1A or disruption of ATF4–TFAM signaling triggers excessive mitophagy, elevates cytosolic Fe 2+ , and sensitizes cancer cells to GPX4 inhibitors (e.g., RSL3), leading to hyperactivation of ferroptosis.

    Article Snippet: Human overexpression plasmids for ATF4 (Addgene #115969) and TFAM (pLV [Exp]-Bsd-CMV > hTFAM [ NM_003201.3 ]) were obtained from Addgene and VectorBuilder, separately.

    Techniques: Gene Expression, Inhibition, Disruption

    Single‐cell RNA‐Seq analysis identifies Atf4 stress response pathway downstream of mitochondrial dysfunction. (a) Experimental setup. (b) UMAP scatterplot showing the distribution of CT and Opa1 cKO‐derived cells clusters. (c) Heatmap of cluster‐specific and genotype‐specific differential gene expression. (d) UMAP of individual genes that are differentially regulated in all the clusters highlighting Atf4 pathway. (e) Violin plots representing mitochondrial gene expression, stress response genes, and differentiation genes in each cluster split by sample. (f) RNA velocity analysis shows the differentiation direction shown by the vectors separated by sample. (g) Panels of magnified views of the transition between cluster 1 (activated NSCs) and cluster 2 (Differentiating NSCs). (h) The proportion of spliced and unspliced RNA in all the clusters split by sample.

    Journal: Aging Cell

    Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration

    doi: 10.1111/acel.14165

    Figure Lengend Snippet: Single‐cell RNA‐Seq analysis identifies Atf4 stress response pathway downstream of mitochondrial dysfunction. (a) Experimental setup. (b) UMAP scatterplot showing the distribution of CT and Opa1 cKO‐derived cells clusters. (c) Heatmap of cluster‐specific and genotype‐specific differential gene expression. (d) UMAP of individual genes that are differentially regulated in all the clusters highlighting Atf4 pathway. (e) Violin plots representing mitochondrial gene expression, stress response genes, and differentiation genes in each cluster split by sample. (f) RNA velocity analysis shows the differentiation direction shown by the vectors separated by sample. (g) Panels of magnified views of the transition between cluster 1 (activated NSCs) and cluster 2 (Differentiating NSCs). (h) The proportion of spliced and unspliced RNA in all the clusters split by sample.

    Article Snippet: ATF4 overexpression from Origene (MR205957) was cloned into the expression vector to generate pLVX‐E2F1a‐Atf4‐Myc‐DDK‐V5‐IRES‐mCherry.

    Techniques: RNA Sequencing, Derivative Assay, Gene Expression

    ATF4 pathway is activated by mitochondrial dysfunction and reductive metabolism under hypoxia resolves ATF4 activation. (a) Western blot of the ISR pathway‐related proteins in E12.5 embryonic cortex of CT and Opa1 KO post Opa1 deletion as mentioned in the plot. (b) Cellular oxygen consumption rate was measured using XF24 extracellular flux analyzer. Bar graphs represent the cellular respiration of basal, maximal, reserved, and ATP‐linked respiration between the listed conditions. n = 3 animals. (c) Normalized mean intensity of MitoSOX Red was calculated from live cells and plotted as bar graph. (d) Phase contrast images of neurospheres from Adult NSCs of CT and Opa1cKO animals in listed Oxygen exposure conditions. (e) Bar graph representing the average number of primary neurospheres formed in CT and Opa1 cKO neurospheres growing under normoxic and hypoxic conditions. n = 3 biological replicates; data are presented as mean ± SD (** p < 0.01, and *** p < 0.001, one‐way ANOVA). (f) Diameter size (in μm) of CT and Opa1 cKO neurospheres grown in hypoxic and normoxic conditions. 120–130 neurospheres measured with n = 3 biological replicates; data are presented as mean ± SD (**** p < 0.0001, One‐way ANOVA). (g) RT‐qPCR results of stress response genes under hypoxic and normoxic conditions. n = 3 animals; data are presented as mean ± SD (** p < 0.01, One‐way ANOVA) (h) Representative western blot image from total protein lysates of embryonic neurospheres (E12.5) treated with LV‐shCtrl or shOpa1 and grown in normoxic and hypoxic conditions. (i) Western blot quantification of ATF4, cl‐Cas3, cyclin A, and Ascl1 in CT and Opa1 KO. Mean intensity was normalized to wild type in the bar graph. n = 5 animals; data are presented as mean ± SD (* p < 0.05, ** < 0.01 and *** < 0.001 One‐way ANOVA). CT, control transgenic; OPA1 cKO, OPA1 conditional knockout; shCtrl, Lentivirus vectors shRNA scramble control; shOPA1, Lentivirus vectors shRNA to OPA1.

    Journal: Aging Cell

    Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration

    doi: 10.1111/acel.14165

    Figure Lengend Snippet: ATF4 pathway is activated by mitochondrial dysfunction and reductive metabolism under hypoxia resolves ATF4 activation. (a) Western blot of the ISR pathway‐related proteins in E12.5 embryonic cortex of CT and Opa1 KO post Opa1 deletion as mentioned in the plot. (b) Cellular oxygen consumption rate was measured using XF24 extracellular flux analyzer. Bar graphs represent the cellular respiration of basal, maximal, reserved, and ATP‐linked respiration between the listed conditions. n = 3 animals. (c) Normalized mean intensity of MitoSOX Red was calculated from live cells and plotted as bar graph. (d) Phase contrast images of neurospheres from Adult NSCs of CT and Opa1cKO animals in listed Oxygen exposure conditions. (e) Bar graph representing the average number of primary neurospheres formed in CT and Opa1 cKO neurospheres growing under normoxic and hypoxic conditions. n = 3 biological replicates; data are presented as mean ± SD (** p < 0.01, and *** p < 0.001, one‐way ANOVA). (f) Diameter size (in μm) of CT and Opa1 cKO neurospheres grown in hypoxic and normoxic conditions. 120–130 neurospheres measured with n = 3 biological replicates; data are presented as mean ± SD (**** p < 0.0001, One‐way ANOVA). (g) RT‐qPCR results of stress response genes under hypoxic and normoxic conditions. n = 3 animals; data are presented as mean ± SD (** p < 0.01, One‐way ANOVA) (h) Representative western blot image from total protein lysates of embryonic neurospheres (E12.5) treated with LV‐shCtrl or shOpa1 and grown in normoxic and hypoxic conditions. (i) Western blot quantification of ATF4, cl‐Cas3, cyclin A, and Ascl1 in CT and Opa1 KO. Mean intensity was normalized to wild type in the bar graph. n = 5 animals; data are presented as mean ± SD (* p < 0.05, ** < 0.01 and *** < 0.001 One‐way ANOVA). CT, control transgenic; OPA1 cKO, OPA1 conditional knockout; shCtrl, Lentivirus vectors shRNA scramble control; shOPA1, Lentivirus vectors shRNA to OPA1.

    Article Snippet: ATF4 overexpression from Origene (MR205957) was cloned into the expression vector to generate pLVX‐E2F1a‐Atf4‐Myc‐DDK‐V5‐IRES‐mCherry.

    Techniques: Activation Assay, Western Blot, Quantitative RT-PCR, Control, Transgenic Assay, Knock-Out, shRNA

    ATF4 function is required for cell proliferation and survival in normal and stressed state. (a) Representative images of EdU and DAPI staining in above mentioned conditions. Cell proliferation is measured using EdU+ cells normalized to total DAPI. (b) Quantification of the percent EdU+ over total DAPI+ cells represented in a bar graph. (c) Representative images of cleaved Caspase 3 (cl‐Cas‐3) and DAPI staining in abovementioned conditions. Cell death is measured using cl‐Cas3+ cells normalized to total DAPI. (d) Quantification of percent cleaved caspase 3+ over total DAPI+ cells represented in bar graph. n = 5–6 biological replicates; Data are presented as mean ± SD (* p < 0.05, ** p < 0.01, and *** p < 0.001, **** p < 0.0001, One‐way ANOVA). (e) RT‐qPCR analysis in mentioned conditions for ATF4 targets involved in amino acid transport, tRNA aminoacylation, export, and one‐carbon metabolism. n = 3–6 animals; Data are presented as mean ± SD (* p < 0.05, ** p < 0.01, and *** p < 0.001, One‐way ANOVA). (f) Schematics indicating the binding of ATF4 in mouse embryonic fibroblasts as identified through ChIP on Chac1, Slc3a2, and Slc7a11 genes (Han et al., ). (g) ATF4 ChIP from shCtrl and shOpa1 KD neurosphere. (h) H3K4me3 ChIP from shCtrl and shOpa1 KD neurosphere. n = 3–6 animals; data are presented as mean ± SEM (* p < 0.05, ** p < 0.01, and *** p < 0.001, 2‐tailed Student's t test). ATF4 OE, ATF4 overexpression vector; scrmch, Lentivirus vectors shRNA scramble mCherry; shATF4, Lentivirus vectors shRNA to ATF4; shCtrl, Lentivirus vectors shRNA scramble control; shOPA1, Lentivirus vectors shRNA to OPA1.

    Journal: Aging Cell

    Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration

    doi: 10.1111/acel.14165

    Figure Lengend Snippet: ATF4 function is required for cell proliferation and survival in normal and stressed state. (a) Representative images of EdU and DAPI staining in above mentioned conditions. Cell proliferation is measured using EdU+ cells normalized to total DAPI. (b) Quantification of the percent EdU+ over total DAPI+ cells represented in a bar graph. (c) Representative images of cleaved Caspase 3 (cl‐Cas‐3) and DAPI staining in abovementioned conditions. Cell death is measured using cl‐Cas3+ cells normalized to total DAPI. (d) Quantification of percent cleaved caspase 3+ over total DAPI+ cells represented in bar graph. n = 5–6 biological replicates; Data are presented as mean ± SD (* p < 0.05, ** p < 0.01, and *** p < 0.001, **** p < 0.0001, One‐way ANOVA). (e) RT‐qPCR analysis in mentioned conditions for ATF4 targets involved in amino acid transport, tRNA aminoacylation, export, and one‐carbon metabolism. n = 3–6 animals; Data are presented as mean ± SD (* p < 0.05, ** p < 0.01, and *** p < 0.001, One‐way ANOVA). (f) Schematics indicating the binding of ATF4 in mouse embryonic fibroblasts as identified through ChIP on Chac1, Slc3a2, and Slc7a11 genes (Han et al., ). (g) ATF4 ChIP from shCtrl and shOpa1 KD neurosphere. (h) H3K4me3 ChIP from shCtrl and shOpa1 KD neurosphere. n = 3–6 animals; data are presented as mean ± SEM (* p < 0.05, ** p < 0.01, and *** p < 0.001, 2‐tailed Student's t test). ATF4 OE, ATF4 overexpression vector; scrmch, Lentivirus vectors shRNA scramble mCherry; shATF4, Lentivirus vectors shRNA to ATF4; shCtrl, Lentivirus vectors shRNA scramble control; shOPA1, Lentivirus vectors shRNA to OPA1.

    Article Snippet: ATF4 overexpression from Origene (MR205957) was cloned into the expression vector to generate pLVX‐E2F1a‐Atf4‐Myc‐DDK‐V5‐IRES‐mCherry.

    Techniques: Staining, Quantitative RT-PCR, Binding Assay, Over Expression, Plasmid Preparation, shRNA, Control

    Slc7a11, a key target of ATF4, and glutathione redox are required for NSC function and survival. (a–d) Histological analysis of phospho‐Histone 3(Proliferation), Ascl1(Activation), Tbr2(TAP), and Dcx(Newborn neurons) in 3 months and 6 months old wild‐type and sut/sut adult mice. n = 4–5 animals; data are presented as mean ± SD (* p < 0.05, ** p < 0.01, and *** p < 0.001, Student's t test). (e) In vitro monolayer culture of WT and Sut mice infected with scramble and shOpa1. Bar graph for percent EdU+ over total DAPI+ cells and (f) Cleaved caspase 3+ over total DAPI+ cells. Data are presented as mean ± SD (* p < 0.05, ** p < 0.01, and *** p < 0.001, Student's t test). (g, h) Glutathione measurement using HPLC of GSH:GSSG ratio and total GSH levels in embryonic neurospheres in mentioned conditions, n = 3 animals; (i) Quantification of percent EdU+ over total DAPI+ cells represented in bar graph for the mentioned conditions. (j) Quantification of percent cleaved caspase 3+ over total DAPI+ cells represented in bar graph. n = 3–4 animals; data are presented as mean ± SD (* p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001, one‐way ANOVA).

    Journal: Aging Cell

    Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration

    doi: 10.1111/acel.14165

    Figure Lengend Snippet: Slc7a11, a key target of ATF4, and glutathione redox are required for NSC function and survival. (a–d) Histological analysis of phospho‐Histone 3(Proliferation), Ascl1(Activation), Tbr2(TAP), and Dcx(Newborn neurons) in 3 months and 6 months old wild‐type and sut/sut adult mice. n = 4–5 animals; data are presented as mean ± SD (* p < 0.05, ** p < 0.01, and *** p < 0.001, Student's t test). (e) In vitro monolayer culture of WT and Sut mice infected with scramble and shOpa1. Bar graph for percent EdU+ over total DAPI+ cells and (f) Cleaved caspase 3+ over total DAPI+ cells. Data are presented as mean ± SD (* p < 0.05, ** p < 0.01, and *** p < 0.001, Student's t test). (g, h) Glutathione measurement using HPLC of GSH:GSSG ratio and total GSH levels in embryonic neurospheres in mentioned conditions, n = 3 animals; (i) Quantification of percent EdU+ over total DAPI+ cells represented in bar graph for the mentioned conditions. (j) Quantification of percent cleaved caspase 3+ over total DAPI+ cells represented in bar graph. n = 3–4 animals; data are presented as mean ± SD (* p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001, one‐way ANOVA).

    Article Snippet: ATF4 overexpression from Origene (MR205957) was cloned into the expression vector to generate pLVX‐E2F1a‐Atf4‐Myc‐DDK‐V5‐IRES‐mCherry.

    Techniques: Activation Assay, In Vitro, Infection