atf4 overexpression mr205957 (OriGene)
Structured Review
Atf4 Overexpression Mr205957, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/atf4+overexpression/Atf4+(NM_009716)+Mouse+Tagged+ORF+Clone/pmc11258489-102-3-3
Average 90 stars, based on 1 article reviews
Images
Related Articles
Over Expression:Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration. Article Snippet: For ATF4 manipulation, pLVX- scramble- mCherry lentiviral expression vector construct was commercially obtained (Clontech 631,987) and used as control. shATF4 knockdown (5′- CCAGAGCATTCCTTTAGTTTA- 3′) to generate pLV- U6- [shAtf4]- mCherry were ordered from Vectorbuilder. .. Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration Article Snippet: For ATF4 manipulation, pLVX‐scramble‐mCherry lentiviral expression vector construct was commercially obtained (Clontech 631,987) and used as control. shATF4 knockdown (5′‐CCAGAGCATTCCTTTAGTTTA‐3′) to generate pLV‐U6‐[shAtf4]‐mCherry were ordered from Vectorbuilder. .. Clone Assay:Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration. Article Snippet: For ATF4 manipulation, pLVX- scramble- mCherry lentiviral expression vector construct was commercially obtained (Clontech 631,987) and used as control. shATF4 knockdown (5′- CCAGAGCATTCCTTTAGTTTA- 3′) to generate pLV- U6- [shAtf4]- mCherry were ordered from Vectorbuilder. .. Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration Article Snippet: For ATF4 manipulation, pLVX‐scramble‐mCherry lentiviral expression vector construct was commercially obtained (Clontech 631,987) and used as control. shATF4 knockdown (5′‐CCAGAGCATTCCTTTAGTTTA‐3′) to generate pLV‐U6‐[shAtf4]‐mCherry were ordered from Vectorbuilder. .. Expressing:Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration. Article Snippet: For ATF4 manipulation, pLVX- scramble- mCherry lentiviral expression vector construct was commercially obtained (Clontech 631,987) and used as control. shATF4 knockdown (5′- CCAGAGCATTCCTTTAGTTTA- 3′) to generate pLV- U6- [shAtf4]- mCherry were ordered from Vectorbuilder. .. Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration Article Snippet: For ATF4 manipulation, pLVX‐scramble‐mCherry lentiviral expression vector construct was commercially obtained (Clontech 631,987) and used as control. shATF4 knockdown (5′‐CCAGAGCATTCCTTTAGTTTA‐3′) to generate pLV‐U6‐[shAtf4]‐mCherry were ordered from Vectorbuilder. .. Plasmid Preparation:Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration. Article Snippet: For ATF4 manipulation, pLVX- scramble- mCherry lentiviral expression vector construct was commercially obtained (Clontech 631,987) and used as control. shATF4 knockdown (5′- CCAGAGCATTCCTTTAGTTTA- 3′) to generate pLV- U6- [shAtf4]- mCherry were ordered from Vectorbuilder. .. Article Title: The integrated stress response promotes neural stem cell survival under conditions of mitochondrial dysfunction in neurodegeneration Article Snippet: For ATF4 manipulation, pLVX‐scramble‐mCherry lentiviral expression vector construct was commercially obtained (Clontech 631,987) and used as control. shATF4 knockdown (5′‐CCAGAGCATTCCTTTAGTTTA‐3′) to generate pLV‐U6‐[shAtf4]‐mCherry were ordered from Vectorbuilder. .. |

